lasergene v11 1 megalign software (DNASTAR)
DNASTAR is a verified supplier 
DNASTAR manufactures this product 
99
Structured Review
DNASTAR
lasergene v11 1 megalign software
Lasergene V11 1 Megalign Software, supplied by DNASTAR, used in various techniques. Bioz Stars score: 99/100, based on 10685 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/megalign+lasergene+software/Lasergene/pm41843571-201-9-14
Average 99 stars, based on 10685 article reviews
Lasergene V11 1 Megalign Software, supplied by DNASTAR, used in various techniques. Bioz Stars score: 99/100, based on 10685 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/megalign+lasergene+software/Lasergene/pm41843571-201-9-14
Average 99 stars, based on 10685 article reviews
lasergene v11 1 megalign software - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Software:Article Title: Emergence of HBV resistance to lamivudine (3TC) in HIV/HBV co-infected patients in The Gambia, West Africa Article Snippet: PCR products were then cleaned using the QIAquick ® agarose gel extraction kit (Qiagen) and sent to Macrogen, Korea for direct single-extension sequencing using the same primers (MMHBRT5 and MMHBRT6) and 3730 × l DNA analyzer (PE Applied Biosystems, Warrington, UK). .. DNA sequences were edited and assembled using SeqMan and aligned using Article Title: Heavy Metal-Resistant PGPR Strains of Pseudomonas sp. Stimulating the Growth of Alfalfa under Cadmium Stress Article Snippet: Three bacteria strains of Pseudomonas sp. resistant to heavy metals were isolated from chemically contaminated soil.. An analysis of the nucleotide sequences of the 16S rRNA and rpoD genes identified the Pseudomonas sp. 17 НМ strain as Pseudomonas capeferrum, and the strains of Pseudomonas sp. 65 НМ and 67 НМ were most closely related to the type strains of Pseudomonas silesiensis and Pseudomonas umsongensis, respectively.. It was shown that the strains of Pseudomonas sp. 17 НМ, 65 НМ, and 67 НМ were characterized by different levels of resistance to heavy metals, with the maximum tolerable concentration (MTC) of zinc being 1 mМ for all strains, that of cadmium, 1, 1.5, and 1 mМ; of lead, 5, 5, and 4 mМ; and of nickel, 7, 9, and 7 mМ, respectively. Article Title: Epidemiological study on tropical theileriosis (Theileria annulata infection) in the Egyptian Oases with special reference to the molecular characterization of Theileria spp. Article Snippet: Theileria annulata infection is a tick-borne disease known as Egyptian fever since 1947.. It is a destructive obstacle for the livestock production in the Egyptian Oases (EL-Wady EL-Geded Province).. The present study was conducted on 1068 cattle, ranged from below one year to more than eight years old; belonged to different farms and villages in EL-Wady EL-Geded Province. Article Title: Development of a real-time multiplex PCR assay for the detection of multiple Salmonella serotypes in chicken samples Article Snippet: .. The design of the primers was based on the multiple alignment of Salmonella and non- Salmonella sequences of the individual genes using Article Title: Molecular sexing of threatened Gyps vultures: an important strategy for conservation breeding and ecological studies Article Snippet: .. The nucleotide sequences for CHD-Z and CHD-W alleles from all species were aligned using Article Title: A novel micronemal protein MP38 is involved in the invasion of merozoites into erythrocytes. Article Snippet: The expected molecular weights of the P. vivax proteins and orthologous proteins in P. knowlesi were predicted using SnapGene software (GSL Biotech LLC, San Diego, CA). .. The amino acid sequence data were aligned using the CLUSTAL-W program in Article Title: A novel micronemal protein MP38 is involved in the invasion of merozoites into erythrocytes Article Snippet: The expected molecular weights of the P. vivax proteins and orthologous proteins in P. knowlesi were predicted using SnapGene software (GSL Biotech LLC, San Diego, CA). .. The amino acid sequence data were aligned using the CLUSTAL-W program in Sequencing:Article Title: Epidemiological study on tropical theileriosis (Theileria annulata infection) in the Egyptian Oases with special reference to the molecular characterization of Theileria spp. Article Snippet: Theileria annulata infection is a tick-borne disease known as Egyptian fever since 1947.. It is a destructive obstacle for the livestock production in the Egyptian Oases (EL-Wady EL-Geded Province).. The present study was conducted on 1068 cattle, ranged from below one year to more than eight years old; belonged to different farms and villages in EL-Wady EL-Geded Province. Article Title: A novel micronemal protein MP38 is involved in the invasion of merozoites into erythrocytes. Article Snippet: The expected molecular weights of the P. vivax proteins and orthologous proteins in P. knowlesi were predicted using SnapGene software (GSL Biotech LLC, San Diego, CA). .. The amino acid sequence data were aligned using the CLUSTAL-W program in Article Title: A novel micronemal protein MP38 is involved in the invasion of merozoites into erythrocytes Article Snippet: The expected molecular weights of the P. vivax proteins and orthologous proteins in P. knowlesi were predicted using SnapGene software (GSL Biotech LLC, San Diego, CA). .. The amino acid sequence data were aligned using the CLUSTAL-W program in Polymerase Chain Reaction:Article Title: Low Helicobacter pylori primary resistance to clarithromycin in gastric biopsy specimens from dyspeptic patients of a city in the interior of São Paulo, Brazil Article Snippet: DNA was quantified in agarose gel electrophoresis using the Invitrogen, Grand Island, New York, USA, low mass ladder and 50-100ug of total DNA were used in the PCR reactions with the oligonucleotides: Hp23Sr6 sense (5′ CACACAGGTAGATGAGATGAGTA3′) and Hp23Sr7 antisense (CACACAGAACCACCGGATCACTA3′), which amplified a fragment of 768pb corresponding to the domain V of the H. pylori 23S rDNA (Figure ). .. To overcome the problems of extensive genetic polymorphism for precise PCR detection of H.pylori , the oligonucleotide construction was performed after a comparative analysis of the 23S rDNA from H.pylori and related organisms available at Genebank on |